CRISPR/Cas12a-Derived electrochemical aptasensor for ultrasensitive detection of COVID-19 nucleocapsid protein.

Fast, affordable, portable, and sensitive technology to detect COVID-19 is critical to address the current outbreak. Here, we present a CRISPR/Cas12a-derived electrochemical aptasensor for cost-effective, fast, and ultrasensitive COVID-19 nucleocapsid protein (Np) detection. First, an electrochemical sensing interface was fabricated by immobilizing methylene blue labeled poly adenines DNA sequence (polyA-MB electrochemical reporter) on a gold electrode surface. Second, an arched probe was prepared via hybridization of Np aptamer and an activator strand. In the presence of COVID-19 Np, the activator strand could be released from the arched probe due to the specific interaction between the target and the aptamer, which then activated the trans-cleavage activity of the CRISPR/Cas12a system. Subsequently, the polyA-MB reporters were cleaved from the electrode surface, decreasing the current of differential pulse voltammetry (DPV) at a potential of -0.27 V(vs. Ag/AgCl). The CRISPR/Cas12a-derived electrochemical aptasensor shows a highly efficient performance for COVID-19 Np detection in 50 pg mL-1 to 100 ng mL-1 with a limit of detection (LOD) low to 16.5 pg mL-1. Notably, the whole process of one test can be completed within 30 min. Simultaneously, the aptasensor displays a high selectivity to other proteins. The further measurements demonstrate that the aptasensor is robust in a natural system for point-of-care testing, such as in tap water, milk, or serum. The aptasensor is universal and expandable and holds great potential in the COVID-19 early diagnosis, environmental surveillance, food security, and other aspects.

Aptamers: The Powerful Molecular Tools for Virus Detection.

Aptamers are short single-stranded DNA or RNA oligonucleotides selected by the technique of systematic evolution of ligands by exponential enrichment (SELEX). Aptamers have been demonstrated to bind various targets from small-molecule to cells or even tissues in the way of antibodies. Thus, they are called chemical antibodies. We summarize and evaluate recent developments in aptamer-based sensors (for short aptasensors) for virus detection in this review. These aptasensors are mainly classified into optical and electronic aptasensors based on the type of transducer. Nowadays, the smartphone has become the most widely used mobile device with billions of users worldwide. Considering the ongoing COVID-19 outbreak, smartphone-based aptasensors for a portable and point-of-care test (POCT) of COVID-19 detection will be of great importance in the future.

Development of Aptamer-Based Molecular Tools for Rapid Intraoperative Diagnosis and In Vivo Imaging of Serous Ovarian Cancer.

Diagnosis and treatment of ovarian cancer are based on intraoperative pathology and debulking surgery. The development of a novel molecular tool is significant for rapid intraoperative pathologic diagnosis, which instructs the decision-making on excision surgery and effective chemotherapy. In this work, we represent a DNA aptamer named mApoc46, which is generated from cell-SELEX by targeting patient-derived primary serous ovarian cancer (pSOC) cells. An average dissociation constant (Kd) was determined to be 0.15 ± 0.05 µM by flow cytometry. The mApoc46 aptamer displays a robust specificity to pSOC cells. Labeled with FAM, mApoc46 can selectively stain living pSOC cells in 30 min without staining commercial OC cell lines and cell lines associated with other cancers. Interestingly, FAM-mApoc46 displayed superb selectivity toward high-grade serous ovarian cancer (HG-SOC) tissues in frozen sections against low-grade SOC, ovarian borderline tumor, other nonepithelial ovarian tumors, and healthy ovarian tissue. These results lead to a potential application in the identification of OCs' histological subtypes during operation. In the patient-derived tumor xenograft NCG mice model, Cy5-labeled mApoc46 was found to accumulate at the tumor area and served as an in vivo imaging probe. The mApoc46 probe shows a robust and stable performance to visualize SOC tumors in the body. Therefore, aptamer mApoc46 holds great potential in rapid intraoperative detection, pathological diagnosis, fluorescence image-guided cancer surgery, and targeted drug delivery and therapy.

NormExpression: An R Package to Normalize Gene Expression Data Using Evaluated Methods.

Data normalization is a crucial step in the gene expression analysis as it ensures the validity of its downstream analyses. Although many metrics have been designed to evaluate the existing normalization methods, different metrics or different datasets by the same metric yield inconsistent results, particularly for the single-cell RNA sequencing (scRNA-seq) data. The worst situations could be that one method evaluated as the best by one metric is evaluated as the poorest by another metric, or one method evaluated as the best using one dataset is evaluated as the poorest using another dataset. Here raises an open question: principles need to be established to guide the evaluation of normalization methods. In this study, we propose a principle that one normalization method evaluated as the best by one metric should also be evaluated as the best by another metric (the consistency of metrics) and one method evaluated as the best using scRNA-seq data should also be evaluated as the best using bulk RNA-seq data or microarray data (the consistency of datasets). Then, we designed a new metric named Area Under normalized CV threshold Curve (AUCVC) and applied it with another metric mSCC to evaluate 14 commonly used normalization methods using both scRNA-seq data and bulk RNA-seq data, satisfying the consistency of metrics and the consistency of datasets. Our findings paved the way to guide future studies in the normalization of gene expression data with its evaluation. The raw gene expression data, normalization methods, and evaluation metrics used in this study have been included in an R package named NormExpression. NormExpression provides a framework and a fast and simple way for researchers to select the best method for the normalization of their gene expression data based on the evaluation of different methods (particularly some data-driven methods or their own methods) in the principle of the consistency of metrics and the consistency of datasets.

Using high-resolution annotation of insect mitochondrial DNA to decipher tandem repeats in the control region.

In this study, we used a small RNA sequencing (sRNA-seq) based method to annotate the mitochondrial genome of the insect Erthesina fullo Thunberg at 1 bp resolution. The high-resolution annotations cover both entire strands of the mitochondrial genome without any gaps or overlaps. Most of the new annotations were consistent with the previous annotations which had been obtained using PacBio full-length transcripts. Two important findings were that animals transcribe both entire strands of mitochondrial genomes and the tandem repeats in the control region of the E. fullo mitochondrial genome contains the repeated Transcription Initiation Sites (TISs) of the heavy strand. In addition, we found that the copy numbers of tandem repeats showed a great diversity within an individual, suggesting that mitochondrial DNA recombination occurs in an individual. In conclusion, the sRNA-seq based method uses 5' and 3' end small RNAs to annotate nuclear non-coding and mitochondrial genes at 1 bp resolution, and can be used to identify new steady RNAs, particularly long non-coding RNAs (lncRNAs). The high-resolution annotations of mitochondrial genomes can also be used to study the molecular phylogenetics and evolution of animals or to investigate mitochondrial gene transcription, RNA processing, RNA maturation and several other related topics. The complete mitochondrial genome sequence of E. fullo with the new annotations using the sRNA-seq based method is available at the NCBI GenBank database under the accession number MK374364. We publish our theories, methods, the high quality sRNA-seq and RNA-seq data (SRA: SRP174926) for extensive use.

Using Pan RNA-Seq Analysis to Reveal the Ubiquitous Existence of 5' and 3' End Small RNAs.

In this study, we used pan RNA-seq analysis to reveal the ubiquitous existence of both 5' and 3' end small RNAs (5' and 3' sRNAs). 5' and 3' sRNAs alone can be used to annotate nuclear non-coding and mitochondrial genes at 1-bp resolution and identify new steady RNAs, which are usually transcribed from functional genes. Then, we provided a simple and cost effective way for the annotation of nuclear non-coding and mitochondrial genes and the identification of new steady RNAs, particularly long non-coding RNAs (lncRNAs). Using 5' and 3' sRNAs, the annotation of human mitochondrial was corrected and a novel ncRNA named non-coding mitochondrial RNA 1 (ncMT1) was reported for the first time in this study. We also found that most of human tRNA genes have downstream lncRNA genes as lncTRS-TGA1-1 and corrected the misunderstanding of them in previous studies. Using 5', 3', and intronic sRNAs, we reported for the first time that enzymatic double-stranded RNA (dsRNA) cleavage and RNA interference (RNAi) might be involved in the RNA degradation and gene expression regulation of U1 snRNA in human. We provided a different perspective on the regulation of gene expression in U1 snRNA. We also provided a novel view on cancer and virus-induced diseases, leading to find diagnostics or therapy targets from the ribonuclease III (RNase III) family and its related pathways. Our findings pave the way toward a rediscovery of dsRNA cleavage and RNAi, challenging classical theories.

Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus.

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.